Review



ocn (reverse)  (PrimerDesign Inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    PrimerDesign Inc ocn (reverse)
    Ocn (Reverse), supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ocn (reverse)/product/PrimerDesign Inc
    Average 90 stars, based on 1 article reviews
    ocn (reverse) - by Bioz Stars, 2026-06
    90/100 stars

    Images



    Similar Products

    ocn reverse (50-30): ctttcgaggcagagagaggg  (Thermo Fisher)
    90
    Thermo Fisher ocn reverse (50-30): ctttcgaggcagagagaggg
    Ocn Reverse (50 30): Ctttcgaggcagagagaggg, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ocn reverse (50-30): ctttcgaggcagagagaggg/product/Thermo Fisher
    Average 90 stars, based on 1 article reviews
    ocn reverse (50-30): ctttcgaggcagagagaggg - by Bioz Stars, 2026-06
    90/100 stars
    		  Buy from Supplier
    ocn reverse (5′-3′): ctttcgaggcagagagaggg  (Thermo Fisher)
    90
    Thermo Fisher ocn reverse (5′-3′): ctttcgaggcagagagaggg

    Ocn Reverse (5′ 3′): Ctttcgaggcagagagaggg, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ocn reverse (5′-3′): ctttcgaggcagagagaggg/product/Thermo Fisher
    Average 90 stars, based on 1 article reviews
    ocn reverse (5′-3′): ctttcgaggcagagagaggg - by Bioz Stars, 2026-06
    90/100 stars
    		  Buy from Supplier
    ocn (reverse)  (PrimerDesign Inc)
    90
    PrimerDesign Inc ocn (reverse)

    Ocn (Reverse), supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ocn (reverse)/product/PrimerDesign Inc
    Average 90 stars, based on 1 article reviews
    ocn (reverse) - by Bioz Stars, 2026-06
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Journal: iScience

    Article Title: Resistin targets TAZ to promote osteogenic differentiation through PI3K/AKT/mTOR pathway

    doi: 10.1016/j.isci.2023.107025

    Figure Lengend Snippet:

    Article Snippet: OCN Reverse (5′-3′): CTTTCGAGGCAGAGAGAGGG , Invitrogen , N/A.

    Techniques: Recombinant, ALP Assay, Flow Cytometry, Sequencing, Plasmid Preparation, Software

    Primer sequences

    Journal: iScience

    Article Title: Resistin targets TAZ to promote osteogenic differentiation through PI3K/AKT/mTOR pathway

    doi: 10.1016/j.isci.2023.107025

    Figure Lengend Snippet: Primer sequences

    Article Snippet: OCN Reverse (5′-3′): CTTTCGAGGCAGAGAGAGGG , Invitrogen , N/A.

    Techniques: Sequencing