Review




Structured Review

PrimerDesign Inc ocn (reverse)
Ocn (Reverse), supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ocn (reverse)/product/PrimerDesign Inc
Average 90 stars, based on 1 article reviews
ocn (reverse) - by Bioz Stars, 2026-06
90/100 stars

Images



Similar Products

90
Thermo Fisher ocn reverse (50-30): ctttcgaggcagagagaggg
Ocn Reverse (50 30): Ctttcgaggcagagagaggg, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ocn reverse (50-30): ctttcgaggcagagagaggg/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
ocn reverse (50-30): ctttcgaggcagagagaggg - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Thermo Fisher ocn reverse (5′-3′): ctttcgaggcagagagaggg

Ocn Reverse (5′ 3′): Ctttcgaggcagagagaggg, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ocn reverse (5′-3′): ctttcgaggcagagagaggg/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
ocn reverse (5′-3′): ctttcgaggcagagagaggg - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
PrimerDesign Inc ocn (reverse)

Ocn (Reverse), supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ocn (reverse)/product/PrimerDesign Inc
Average 90 stars, based on 1 article reviews
ocn (reverse) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results


Journal: iScience

Article Title: Resistin targets TAZ to promote osteogenic differentiation through PI3K/AKT/mTOR pathway

doi: 10.1016/j.isci.2023.107025

Figure Lengend Snippet:

Article Snippet: OCN Reverse (5′-3′): CTTTCGAGGCAGAGAGAGGG , Invitrogen , N/A.

Techniques: Recombinant, ALP Assay, Flow Cytometry, Sequencing, Plasmid Preparation, Software

Primer sequences

Journal: iScience

Article Title: Resistin targets TAZ to promote osteogenic differentiation through PI3K/AKT/mTOR pathway

doi: 10.1016/j.isci.2023.107025

Figure Lengend Snippet: Primer sequences

Article Snippet: OCN Reverse (5′-3′): CTTTCGAGGCAGAGAGAGGG , Invitrogen , N/A.

Techniques: Sequencing